Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BMV3_UPD-PK4

PKB-number: PKB157
Definition: Pseudoknot PK4 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA3
Organism: brome mosaic virus
Abbreviation: BMV3_UPD-PK4
RNA type: Viral 3 UTR
Keywords: bromovirus; translational regulation; replication
EMBL number: V00099
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses" (Brinton M.A. & Rueckert R., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
[2] Lahser F.C. et al. (1993). J. Virol. 67:3295-3303.
Comment: RNAs 1 and 2 of BMV contain similar structures. Subgenomic RNA4 is derived from RNA3, with the same 3'end.
Stem sizes:
Loop sizes:
3 6
3 0 3
Position Paired:
1922-1924; 1934-1936
1928-1933; 1940-1945
Bracket view of structure:
                   1930      1940
      #      123456789|123456789|123456
      $ 1921 UUGUUGAAUCAGUACAAUAACUGAUA=1946
      % 1921 :(((:::[[[[[[))):::]]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-17 PKB00157.html