Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TRV-PSG2_PK2

PKB-number: PKB159
Definition: Pseudoknot PK2 of the pseudoknot domain of RNA2
Organism: tobacco rattle virus, strain PSG
Abbreviation: TRV-PSG2_PK2
RNA type: Viral others
Keywords: tobravirus
EMBL number: X03686
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses" (Brinton M.A. & Rueckert R., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
Comment: Homologous pseudoknots are folded in TRV RNA2 from TCM and CAM strains [1].
Stem sizes:
Loop sizes:
3 5
1 1 4
Position Paired:
1244-1246; 1254-1256
1248-1251; 1263-1266
1252-1252; 1261-1261
Bracket view of structure:
                 1250      1260
      #      3456789|123456789|1234567
      $ 1243 GGGCGGGUGUCGCCAGAAAUCACCG=1267
      % 1243 :(((:[[[[[:)))::::]:]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-17 PKB00159.html