Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TRV-PSG2_PK4

PKB-number: PKB161
Definition: Pseudoknot PK4 of the pseudoknot domain of RNA2
Organism: tobacco rattle virus, strain PSG
Abbreviation: TRV-PSG2_PK4
RNA type: Viral others
Keywords: tobravirus
EMBL number: X03686
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses" (Brinton M.A. & Rueckert R., Eds), Alan R. Liss, Inc., New York, pp 299-316.
Comment: Homologous pseudoknot is folded in TRV RNA2 from TCM strain [1].
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
1348-1350; 1358-1360
1352-1357; 1364-1369
Bracket view of structure:
             1350      1360      1370
      #      789|123456789|123456789|
      $ 1347 AGGUGGAUGUUACCAUAAACAUUA=1370
      % 1347 :(((:[[[[[[))):::]]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-17 PKB00161.html