Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TRV-PSG2_PK5

PKB-number: PKB162
Definition: Pseudoknot PK5 of the pseudoknot domain of RNA2
Organism: tobacco rattle virus, strain PSG
Abbreviation: TRV-PSG2_PK5
RNA type: Viral others
Keywords: tobravirus
EMBL number: X03686
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses" (Brinton M.A. & Rueckert P., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
Comment: Homologous pseudoknot is folded in TRV RNA2 from TCM strain [1].
Stem sizes:
Loop sizes:
6 5
1 0 10
Position Paired:
1370-1375; 1382-1387
1377-1381; 1398-1402
Bracket view of structure:
           1370      1380      1390      1400
      #      9|123456789|123456789|123456789|123
      $ 1369 UAAUGUCGCAGGUGGCAUUUUAAAAUAAGACCUGA=1403
      % 1369 :((((((:[[[[[))))))::::::::::]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-17 PKB00162.html