Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Hs_SRP-pkn

PKB-number: PKB163
Definition: The pseudoknot of signal recognition particle RNA
Organism: Homo sapiens
Abbreviation: Hs_SRP-pkn
RNA type: Others
Keywords: signal recognition particle; ribonucleoprotein; protein translocation
EMBL number: V00588
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; 3D-modelling
References: [1] Zwieb C. et al. (1998). In: "Molecular Modeling of Nucleic Acids" (Leontis N.B. & SantaLucia J., Eds.), ACS Symposium Series, v.682, American Chemical Society, Washington DC, pp 405-413.
[2] Zwieb C.& Samuelsson T. (2000). Nucleic Acids Res. 28:171-172. (database: http://psyche.uthct.edu/dbs/SRPDB/SRPDB.html).
Comment: The structure is conserved in many different SRP RNAs [1]. For the SRP database, see [2]. The numbering is shown as in [1].
Stem sizes:
Loop sizes:
6 4 4
1 1 5 1 3
Position Paired:
5-10; 17-22
28-31; 40-43
12-15; 33-36
1-3; 44-46
Bracket view of structure:
                  10        20        30        40
      #   123456789|123456789|123456789|123456789|1234567
      $ 1 GCCGGGCGCGGUGGCGCGUGCCUGUAGUCCCAGCUACUCGGGAGGCU=47
      % 1 (((:((((((:[[[[:)))))):::::((((:]]]]:::))))))):   

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-22 PKB00163.html