Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PSLVbeta_UPD-PK1

PKB-number: PKB165
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta
Organism: poa semilatent virus
Abbreviation: PSLVbeta_UPD-PK1
RNA type: Viral 3 UTR
Keywords: hordeivirus
EMBL number: M81486
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Solovyev A.G. et al. (1996). Virology 219:9-18.
Stem sizes:
Loop sizes:
3 5
1 0 4
Position Paired:
3359-3361; 3368-3370
3363-3367; 3375-3379
Bracket view of structure:
            3360      3370      3380
      #      89|123456789|123456789|
      $ 3358 AUUGCCACUGUGGAAAUCAGUGA=3380
      % 3358 :(((:[[[[[)))::::]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-22 PKB00165.html