Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PSLVbeta_UPD-PK2

PKB-number: PKB166
Definition: Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta
Organism: poa semilatent virus
Abbreviation: PSLVbeta_UPD-PK2
RNA type: Viral 3 UTR
Keywords: hordeivirus
EMBL number: M81486
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Solovyev A.G. et al. (1996). Virology 219:9-18.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
3382-3384; 3392-3394
3386-3391; 3398-3403
Bracket view of structure:
                   3390      3400
      #      123456789|123456789|1234=3404
      $ 3381 CGGUUUUAUCUACCAUAAGAUAAA
      % 3381 :(((:[[[[[[))):::]]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-22 PKB00166.html