Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PSLVbeta_UPD-PK3

PKB-number: PKB167
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta
Organism: poa semilatent virus
Abbreviation: PSLVbeta_UPD-PK3
RNA type: Viral 3 UTR
Keywords: hordeivirus
EMBL number: M81486
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Solovyev A.G. et al. (1996). Virology 219:9-18.
Stem sizes:
Loop sizes:
4 8
2 0 6
Position Paired:
3404-3407; 3418-3421
3410-3416; 3430-3436
3417-3417; 3428-3428
Bracket view of structure:
                 3410      3420      3430
      #      3456789|123456789|123456789|1234567
      $ 3403 AAGUGUUUUCAUGUCCACUUAAAUCGAACAUGAAC=3437
      % 3403 :((((::[[[[[[[[))))::::::]:]]]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-23 PKB00167.html