Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
LRSVbeta

PKB-number: PKB168
Definition: tRNA-like structure 3'end pseudoknot of RNA beta
Organism: lychnis ringspot virus
Abbreviation: LRSVbeta
RNA type: Viral tRNA-like
Keywords: hordeivirus; RNA 3'end
EMBL number: Z46351
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Solovyev A.G. et al. (1996). Virology 219:9-18.
Stem sizes:
Loop sizes:
13 5
3 2 34
Position Paired:
2997-3004; 3050-3057
3009-3013; 3024-3028
3017-3021; 3092-3096
3034-3039; 3044-3049
3059-3068; 3074-3083
Bracket view of structure:
              3000      3010      3020      3030      3040      3050
      #      6789|123456789|123456789|123456789|123456789|123456789|12345
      $ 2996 AUUGGUGAUUAUUUCCGCUUACUCCUGUGCGGAUGCAACAAUGUUUUGACAUUGAUCACU=3055
      % 2996 :((((((((::::(((((:::[[[[[::))))):::::((((((::::))))))))))))
              3060      3070      3080      3090      3100
      #      6789|123456789|123456789|123456789|123456789|
      $ 3056 GAGUUUCAGACUGACUAACAGUCUGGGAUCCCCCAAGGGAGACCA=3100
      % 3056 )):((((((((((:::::))))))))))::::::::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-23 PKB00168.html