Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CoxB3

PKB-number: PKB169
Definition: "Kissing" interaction in the 3'UTR
Organism: Coxsackie B virus
Abbreviation: CoxB3
RNA type: Viral 3 UTR
Keywords: Picornavirus; enterovirus; kissing interaction
EMBL number: M33854
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing; 3D-modelling
References: [1] Pilipenko E.V. et al. (1992). Nucleic Acids Res. 20:1739-1745.
[2] Melchers W.J.G. et al. (1997). J. Virol. 71:686-696.
Stem sizes:
Loop sizes:
12 6 7
1 9 5 1 0
Position Paired:
7336-7347; 7364-7375
7381-7382; 7402-7403
7384-7388; 7396-7400
7349-7354; 7390-7395
Bracket view of structure:
               7340      7350      7360      7370      7380      7390
      #      56789|123456789|123456789|123456789|123456789|123456789|1234
      $ 7335 ACCCUACUGUGCUAACCGAACCAGAUAACGGUACAGUAGGGGUAAAUUCUCCGCAUUCGG=7394
      % 7335 :((((((((((((:[[[[[[:::::::::)))))))))))):::::((:(((((:]]]]]
               7400
      #      56789|1234567
      $ 7395 UGCGGAAAAAAAA=7407
      % 7395 ]))))):))::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-23 PKB00169.html