Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ColIb-P9_repZ

PKB-number: PKB170
Definition: Pseudoknot of the regulatory region of the repZ gene
Organism: plasmid ColIb-P9
Abbreviation: ColIb-P9_repZ
RNA type: mRNA
Keywords: plasmid replication; molecular switch; translational initiation
EMBL number: AB021078
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Structure probing
References: [1] Asano K. & Mizobuchi K. (1998). J. Biol. Chem. 273:11815-11825.
Stem sizes:
Loop sizes:
18 10
9 1 75
Position Paired:
295-297; 353-355
302-316; 338-352
326-332; 435-441
334-336; 431-433
Bracket view of structure:
                300       310       320       330       340       350
      #     456789|123456789|123456789|123456789|123456789|123456789|123456(73)
      $ 294 AAGGAAAACCCCCACUAUCUUUCUUACGAACUUGGCGGAACGACGAAAGAUAGUGGGGGCCUC=356
      % 294 :(((::::(((((((((((((((:::::::::[[[[[[[:[[[:)))))))))))))))))):
          430       440
      # (73)|123456789|12
      $ 430 AUCGCUCCGCCAU=442
      % 430 :]]]:]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-23 PKB00170.html