Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HCV_229E

PKB-number: PKB171
Definition: ORF1a/ORF1b (polymerase) ribosomal frameshift site
Organism: human coronavirus 229E
Abbreviation: HCV_229E
RNA type: Viral Frameshift
Keywords: coronavirus; ribosomal frameshifting; polymerase
EMBL number: X69721
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Herold J. & Siddell S.G. (1993). Nucleic Acids Res. 21:5838-5842.
Stem sizes:
Loop sizes:
12 5 7
3 0 156 2 1
Position Paired:
12526-12537; 12546-12557
12541-12545; 12723-12727
12714-12720; 12729-12735
Bracket view of structure:
                12520     12530     12540     12550     12560
      #       456789|123456789|123456789|123456789|123456789|(149)
      $ 12514 UUUAAACGAGUCCGGGGCUCUAGUGCCGCUCGACUAGAGCCCUGUAA=12560
      % 12514 ::::::::::::((((((((((((:::[[[[[)))))))))))):::
          12710     12720     12730
      # (149) |123456789|123456789|1234567
      $ 12710 CAGUUAUGGACCACGAGCAGUCCAUGUA=12737
      % 12710 ::::(((((((::]]]]]:)))))))::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-23 PKB00171.html