Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
satRPV

PKB-number: PKB173
Definition: Attenuator pseudoknot of the hammerhead ribozyme
Organism: Satellite cereal yellow dwarf virus-RPV RNA
Abbreviation: satRPV
RNA type: Ribozymes
Keywords: satellite RNA; kissing interaction; molecular switch
EMBL number: M63666
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis
References: [1] Miller W.A & Silver S.L. (1991). Nucleic Acids Res. 19:5313-5320.
[2] Song S.I. et al. (1999). J. Mol. Biol. 293:781-793.
Comment: The "kissing" interaction (6-10/30-34) inhibits self-cleavage in monomeric satRPV RNA, but is required in multimers for efficient replication by a rolling circle mechanism [1,2]. SatRPV RNA was previously called satellite RNA of barley yellow dwarf virus (sBYDV).
Stem sizes:
Loop sizes:
4 5 5
1 2 8 0 33
Position Paired:
1-4; 13-16
25-29; 68-72
35-38; 56-59
43-46; 51-54
6-10; 30-34
Bracket view of structure:
                  10        20        30        40        50        60
      #   123456789|123456789|123456789|123456789|123456789|123456789|
      $ 1 ACAGAGCGCGUACUGUCUGACGACGUAUCCGCGCGGACUAGAAGGCUGGUGCCUCGUCCA=60
      % 1 ((((:[[[[[::))))::::::::(((((]]]]]((((::::((((::::)))):)))):
                   70
      #    123456789|123
      $ 61 ACAAAUAGAUACA=73
      % 61 :::::::))))):   

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-23 PKB00173.html