Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
RSV

PKB-number: PKB174
Definition: Gag/pol ribosomal frameshift site
Organism: Rous sarcoma virus
Abbreviation: RSV
RNA type: Viral Frameshift
Keywords: Avian type C retrovirus; ribosomal frameshifting; gag/pol
EMBL number: V01197
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Structure probing
References: [1] Jacks T. et al. (1988). Cell 55:447-458.
[2] Marczinke B. et al. (1998). J. Mol. Biol. 284:205-225.
Stem sizes:
Loop sizes:
14 8
11 52 11
Position Paired:
2484-2488; 2579-2583
2489-2497; 2569-2577
2517-2522; 2541-2546
2525-2529; 2536-2540
2547-2552; 2557-2562
2509-2516; 2595-2602
Bracket view of structure:
              2480      2490      2500      2510      2520      2530      2540
      #      6789|123456789|123456789|123456789|123456789|123456789|123456789|
      $ 2476 AAAUUUAUAGGGAGGGCCACUGUUCUCACUGUUGCGCUACAUCUGGCUAUUCCGCUCAAAUGGAA=2540
      % 2476 ::::::::((((((((((((((:::::::::::[[[[[[[[((((((::(((((::::::)))))
                   2550      2560      2570      2580      2590      2600
      #      123456789|123456789|123456789|123456789|123456789|123456789|123
      $ 2541 GCCAGACCACACGCCUGUGUGGAUUGACCAGUGGCCCCUCCCUGAAGGUAAACUUGUAGCGCU=2603
      % 2541 ))))))((((((::::))))))::::::))))))))):))))):::::::::::]]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-1-6 PKB00174.html