Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
biotin-PK

PKB-number: PKB175
Definition: Biotin-binding RNA pseudoknot
Organism:
Abbreviation: biotin-PK
RNA type: Aptamers
Keywords: biotin; SELEX
EMBL number:
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing; 3D-modelling
References: [1] Wilson C. & Szostak J.W. (1995). Nature 374:777-782.
[2] Wilson C. et al. (1998). Biochemistry 37:14410-14419.
Stem sizes:
Loop sizes:
5 7
1 0 30
Position Paired:
19-23; 32-36
25-31; 67-73
Bracket view of structure:
            20        30        40        50        60        70
      #    89|123456789|123456789|123456789|123456789|123456789|1234
      $ 18 CACCGACCAUAGGCUCGGGUUGCCAGAGGUUCCACACUUUCAUCGAAAAGCCUAUGC=74
      % 18 :(((((:[[[[[[[)))))::::::::::::::::::::::::::::::]]]]]]]:   

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-1-6 PKB00175.html