Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
biotin-PK-AN69.1

PKB-number: PKB176
Definition: Biotin-binding pseudoknot
Organism:
Abbreviation: biotin-PK-AN69.1
RNA type: Aptamers
Keywords: biotin; SELEX
EMBL number:
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Crystal structure; Mutagenesis; Sequence comparison
References: [1] Wilson C. et al. (1998). Biochemistry 37:14410-14419.
[2] Nix J.C. et al. (1999). Acta Cryst. D55:323-325.
[3] Nix J.C. et al. (2000). J. Mol. Biol. 296:1235-1244.
Stem sizes:
Loop sizes:
5 6
2 0 6
Position Paired:
3-7; 16-20
10-15; 27-32
Bracket view of structure:
                  10        20        30
      #   123456789|123456789|123456789|123
      $ 1 GGACCGUCAGAGGACACGGUUAAAAAGUCCUCU=33
      % 1 ::(((((::[[[[[[)))))::::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-6-16 PKB00176.html