Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Rr_ODCanti

PKB-number: PKB177
Definition: Antizyme ribosomal frameshifting site
Organism: Rattus rattus (black rat)
Abbreviation: Rr_ODCanti
RNA type: Others
Keywords: mammalia; ornithine decarboxylase; antizyme; ribosomal frameshifting
EMBL number: D10706
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Matsufuji S. et al. (1995). Cell 80:51-60.
[2] Matsufuji S. et al. (1996). EMBO J. 15:1360-1370.
Stem sizes:
Loop sizes:
11 6
6 1 10
Position Paired:
262-266; 294-298
268-273; 287-292
280-285; 309-314
Bracket view of structure:
          250       260       270       280       290       300       310
      #     |123456789|123456789|123456789|123456789|123456789|123456789|123456789
      $ 250 UGCUCCUGAUGUCCCUCACCCACCCCUGAAGAUCCCAGGUGGGCGAGGGAACAGUCAGCGGGAUCACAGU=319
      % 250 ::::::::::::(((((:((((((::::::[[[[[[:)))))):)))))::::::::::]]]]]]:::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-6-16 PKB00177.html