Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
pMU407_repBA

PKB-number: PKB179
Definition: Pseudoknot of the regulatory region of the repBA gene
Organism: plasmid pMU407.1 (IncL/M)
Abbreviation: pMU407_repBA
RNA type: mRNA
Keywords: plasmid replication; molecular switch; translational initiation; IncL/M
EMBL number: U27345
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Athanasopoulos V. et al. (1995). J. Bact. 177:4730-4741.
[2] Athanasopoulos V. et al. (1999). J. Bact. 181:1811-1819.
Stem sizes:
Loop sizes:
19 8
3 1 58
Position Paired:
558-567; 601-610
569-575; 593-599
577-578; 591-592
582-589; 669-676
Bracket view of structure:
             560       570       580       590       600       610
      #     789|123456789|123456789|123456789|123456789|123456789|1 (56)
      $ 557 AACCCCCUGAUCCUAUUUCAGAACUUUGGCCGGCUCGGAAUAGAAUCAGGGGGUG=611
      % 557 :((((((((((:(((((((:((:::[[[[[[[[:))))))))):)))))))))):
            670       680
      #     89|123456789|
      $ 668 CCCGGCCAAUAUG=680
      % 668 :]]]]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-6-16 PKB00179.html