Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
pMU720_repBA

PKB-number: PKB180
Definition: Pseudoknot of the regulatory region of the repBA gene
Organism: plasmid pMU720 (IncB)
Abbreviation: pMU720_repBA
RNA type: mRNA
Keywords: plasmid replication; molecular switch; translational initiation; IncB
EMBL number: M28718
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Praszkier J. et al. (1992). J. Bact. 174:2376-2383.
[2] Wilson I.W. et al. (1997). J. Bact. 179:742-753.
Stem sizes:
Loop sizes:
16 7
4 1 83
Position Paired:
569-574; 613-618
576-583; 604-611
586-587; 600-601
592-598; 702-708
Bracket view of structure:
            570       580       590       600       610       620
      #     89|123456789|123456789|123456789|123456789|123456789| (79)
      $ 568 ACCCCCACUAUUUUUCCUCGAACUUGGCGGAACGCAGAAAAAUAAUGGGGGCC=620
      % 568 :((((((:((((((((::((::::[[[[[[[:))::)))))))):))))))::
            700       710
      #  700  |123456789|
      $  700  GCUCCGCCAUA=710
      %       ::]]]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-6-16 PKB00180.html