Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HCV_IRES

PKB-number: PKB181
Definition: domain IIIef of IRES RNA
Organism: hepatitis C virus
Abbreviation: HCV_IRES
RNA type: Viral 5 UTR
Keywords: flaviviridae; internal ribosomal entry site; translation
EMBL number: M62321
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing; small-angle X-ray scattering (SAXS)
References: [1] Brown E.A. et al. (1992). Nucleic Acids Res. 20:5041-5045.
[2] Kieft J.S. et al. (1999). J. Mol. Biol. 292:513-529.
Stem sizes:
Loop sizes:
11 6
1 1 1
Position Paired:
125-133; 315-323
134-135; 289-290
291-293; 300-302
303-304; 313-314
306-311; 325-330
Bracket view of structure:
               130
      #     56789|123456(151)
      $ 125 CCUCCCGGGAGA=136
      % 125 (((((((((((:
            290       300       310       320       330
      #(151)89|123456789|123456789|123456789|123456789|1
      $ 288 ACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAG=331
      % 288 :))(((::::::)))((:[[[[[[:))))))))))):]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00181.html