Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBRMV1-PKa

PKB-number: PKB182
Definition: tRNA-like structure 3'end pseudoknot of RNA1
Organism: soil-borne rye mosaic virus
Abbreviation: SBRMV1-PKa
RNA type: Viral tRNA-like
Keywords: furovirus; RNA 3'end
EMBL number: AF146278
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 5
4 0 3
Position Paired:
7000-7002; 7012-7014
7007-7011; 7018-7022
Bracket view of structure:
               6990      7000      7010      7020
      #      56789|123456789|123456789|123456789|123456
      $ 6985 GGGGUUCAAAUCCCCCCCCGAACCGGAGGGUUAUCCGGCCCA=7026
      % 6985 :::::::::::::::(((::::[[[[[))):::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00182.html