Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBRMV1_UPD-PKc

PKB-number: PKB184
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne rye mosaic virus
Abbreviation: SBRMV1_UPD-PKc
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: AF146278
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
5 6
1 0 6
Position Paired:
6828-6832; 6840-6844
6834-6839; 6851-6856
Bracket view of structure:
             6830      6840      6850
      #      789|123456789|123456789|1234567
      $ 6827 UUCUGUUUUUCGAACAGAUGUAAAUCGAAGA=6857
      % 6827 :(((((:[[[[[[)))))::::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00184.html