Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBRMV1_UPD-PKd

PKB-number: PKB185
Definition: Pseudoknot PKd of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne rye mosaic virus
Abbreviation: SBRMV1_UPD-PKd
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: AF146278
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
6806-6808; 6816-6818
6810-6815; 6822-6827
Bracket view of structure:
               6810      6820
      #      56789|123456789|12345678
      $ 6805 ACGUGGCCAUCACGAUAGAUGGUU=6828
      % 6805 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00185.html