Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBRMV1_UPD-PKe

PKB-number: PKB186
Definition: Pseudoknot PKe of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne rye mosaic virus
Abbreviation: SBRMV1_UPD-PKe
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: AF146278
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
5 5
1 2 4
Position Paired:
6779-6783; 6792-6796
6785-6789; 6801-6805
Bracket view of structure:
            6780      6790      6800
      #      89|123456789|123456789|123456
      $ 6778 AAGCCUAUUUGUACGGGUUGAGUACAAAC=6806
      % 6778 :(((((:[[[[[::)))))::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00186.html