Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBRMV1_UPD-PKf

PKB-number: PKB187
Definition: Pseudoknot PKf of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne rye mosaic virus
Abbreviation: SBRMV1_UPD-PKf
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: AF146278
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
4 4
3 0 6
Position Paired:
6749-6752; 6760-6763
6756-6759; 6770-6773
Bracket view of structure:
            6750      6760      6770
      #      89|123456789|123456789|1234
      $ 6748 GCCGCUGGGAUUGCGGAUUAUAAAUCG=6774
      % 6748 :((((:::[[[[))))::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00187.html