Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBRMV1_UPD-PKg

PKB-number: PKB188
Definition: Pseudoknot PKg of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne rye mosaic virus
Abbreviation: SBRMV1_UPD-PKg
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: AF146278
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 5
2 0 3
Position Paired:
6726-6728; 6736-6738
6731-6735; 6742-6746
Bracket view of structure:
               6730      6740
      #      56789|123456789|1234567
      $ 6725 UCGUUGCCGUCACGAUAGACGGA=6747
      % 6725 :(((::[[[[[))):::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00188.html