Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBRMV1_UPD-PKh

PKB-number: PKB189
Definition: Pseudoknot PKh of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne rye mosaic virus
Abbreviation: SBRMV1_UPD-PKh
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: AF146278
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
4 7
1 0 3
Position Paired:
6700-6703; 6712-6715
6705-6711; 6719-6725
Bracket view of structure:
           6700      6710      6720
      #      9|123456789|123456789|123456
      $ 6699 AGUCUAACAUGUCGGGCUGAGACAUGUC=6726
      % 6699 :((((:[[[[[[[)))):::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00189.html