 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| AMV3 | 
| |||
| PKB-number: | PKB191 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA3 |
| Organism: | alfalfa mosaic virus |
| Abbreviation: | AMV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | alfamovirus; replication |
| EMBL number: | K03542 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing; adenylation |
| References: | [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864. |
| Comment: | Similar structures can be folded in other related alfamo-, bromo-, cucumo-, hordei-, ilarvirus RNAs [1]. |
| Stem sizes: Loop sizes: |
16 4 3 0 61 |
| Position Paired: | 2031-2040; 2064-2073 2041-2046; 2054-2059 2050-2053; 2135-2138 2076-2087; 2092-2103 2108-2114; 2119-2125 |
| Bracket view of structure: |
2030 2040 2050 2060 2070 2080
# |123456789|123456789|123456789|123456789|123456789|123456789
$ 2030 AGGUAUGAAGUCCUAUUCGCUCCUGAUAGGAUCGACUUCAUAUUGCUUAUAUAUGUGCUA=2089
% 2030 :((((((((((((((((:::[[[[))))))::::))))))))))::((((((((((((::
2090 2100 2110 2120 2130 2140
# |123456789|123456789|123456789|123456789|123456789|12
$ 2090 ACGCACAUAUAUAAAUGCUCAUGCAAAACUGCAUGAAUGCCCCUAAGGGAUGC=2142
% 2090 ::))))))))))))::::(((((((::::))))))):::::::::]]]]::::