Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
AMV3

PKB-number: PKB191
Definition: tRNA-like structure 3'end pseudoknot of RNA3
Organism: alfalfa mosaic virus
Abbreviation: AMV3
RNA type: Viral tRNA-like
Keywords: alfamovirus; replication
EMBL number: K03542
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing; adenylation
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
Comment: Similar structures can be folded in other related alfamo-, bromo-, cucumo-, hordei-, ilarvirus RNAs [1].
Stem sizes:
Loop sizes:
16 4
3 0 61
Position Paired:
2031-2040; 2064-2073
2041-2046; 2054-2059
2050-2053; 2135-2138
2076-2087; 2092-2103
2108-2114; 2119-2125
Bracket view of structure:
          2030      2040      2050      2060      2070      2080
      #      |123456789|123456789|123456789|123456789|123456789|123456789
      $ 2030 AGGUAUGAAGUCCUAUUCGCUCCUGAUAGGAUCGACUUCAUAUUGCUUAUAUAUGUGCUA=2089
      % 2030 :((((((((((((((((:::[[[[))))))::::))))))))))::((((((((((((::
          2090      2100      2110      2120      2130      2140
      #      |123456789|123456789|123456789|123456789|123456789|12
      $ 2090 ACGCACAUAUAUAAAUGCUCAUGCAAAACUGCAUGAAUGCCCCUAAGGGAUGC=2142
      % 2090 ::))))))))))))::::(((((((::::))))))):::::::::]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00191.html