Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Qbeta_PKldX

PKB-number: PKB192
Definition: A long-range pseudoknot
Organism: bacteriophage Q-beta
Abbreviation: Qbeta_PKldX
RNA type: Viral others
Keywords: bacteriophage; replication; replicase; RNA 3'end
EMBL number: X14764
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Klovins J. & van Duin J. (1999). J. Mol. Biol. 294:875-884.
Stem sizes:
Loop sizes:
8 9
1204 2 0
Position Paired:
2972-2979; 4195-4202
4184-4192; 4203-4211
Bracket view of structure:
          2970      2980
      #      |123456789| (1202)
      $ 2970 AAUAAAGCAGU=2980
      % 2970 ::((((((((:
                 4190      4200      4210
      #(1202)3456789|123456789|123456789|1234567
      $ 4183 UGAGAGGGGGAUCUGCUUUGCCCUCUCUCCUCCCA=4217
      % 4183 :[[[[[[[[[::))))))))]]]]]]]]]::::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00192.html