Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_rpmI

PKB-number: PKB193
Definition: Long-range pseudoknot in the IF3-L35-L20 operon (rpmI)
Organism: Escherichia coli
Abbreviation: Ec_rpmI
RNA type: mRNA
Keywords: translation; translational control; translation initiation factor; ribosomal protein
EMBL number: V00291
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Structure probing
References: [1] Chiaruttini C. et al. (1996). EMBO J. 15:4402-4413.
Stem sizes:
Loop sizes:
18 6
4 0 261
Position Paired:
2573-2573; 2623-2623
2575-2576; 2621-2622
2578-2585; 2613-2620
2588-2594; 2606-2612
2599-2600; 2890-2891
2602-2605; 2885-2888
2892-2894; 2909-2911
2897-2899; 2905-2907
Bracket view of structure:
                  2580      2590      2600      2610      2620
      #      23456789|123456789|123456789|123456789|123456789|1234(259)
      $ 2572 ACAGAUGAAGGCGACUAUCAGGUAAAACUCCGCAGCCUGAUUCGCUUUCUCGA=2624
      % 2572 :(:((:((((((((::(((((((::::[[:[[[[)))))))))))))))))):
                2890      2900      2910
      #(259) 456789|123456789|123456789|12
      $ 2884 AUGCGAAGUGGAAGUUAUUAAAAUGCCAA=2912
      % 2884 :]]]]:]](((::(((:::::))):))):

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2000-12-21 PKB00193.html