Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1_UPD-PKb

PKB-number: PKB194
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1_UPD-PKb
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 7
1 0 4
Position Paired:
6932-6934; 6943-6945
6936-6942; 6950-6956
Bracket view of structure:
          6930      6940      6950
      #      |123456789|123456789|1234567
      $ 6930 UACGCUGUACAGUGCGUUAAACUGUACA=6957
      % 6930 ::(((:[[[[[[[)))::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00194.html