Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1_UPD-PKc

PKB-number: PKB195
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1_UPD-PKc
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1]Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
5 6
1 0 6
Position Paired:
6902-6906; 6914-6918
6908-6913; 6925-6930
Bracket view of structure:
                   6910      6920      6930
      #      123456789|123456789|123456789|1
      $ 6901 CUCUGUUGAUCAAACAGAAAUAAAUUGAUUA=6931
      % 6901 :(((((:[[[[[[)))))::::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00195.html