Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1_UPD-PKd

PKB-number: PKB196
Definition: Pseudoknot PKd of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1_UPD-PKd
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
6880-6882; 6890-6892
6884-6889; 6896-6901
Bracket view of structure:
           6880      6890      6900
      #      9|123456789|123456789|12
      $ 6879 ACGCGGUCAUUGCGAUAAAUGACU=6902
      % 6879 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00196.html