Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1_UPD-PKe

PKB-number: PKB197
Definition: Pseudoknot PKe of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1_UPD-PKe
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
4 5
1 2 5
Position Paired:
6854-6857; 6866-6869
6859-6863; 6875-6879
Bracket view of structure:
                   6860      6870      6880
      #       23456789|123456789|123456789|
      $  6852 GAACCUAUUUGCUCGGGUUGAGUGCAAAC=6880
      %  6852 ::((((:[[[[[::)))):::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00197.html