Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1_UPD-PKf

PKB-number: PKB198
Definition: Pseudoknot PKf of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1_UPD-PKf
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
4 5
2 0 9
Position Paired:
6823-6826; 6834-6837
6829-6833; 6847-6851
Bracket view of structure:
                   6830      6840      6850
      #       23456789|123456789|123456789|123
      $  6822 ACCGCCUGAUUAGCGGUCUACAAGUUAAUCGA=6853
      %  6822 :((((::[[[[[)))):::::::::]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00198.html