Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1_UPD-PKg

PKB-number: PKB199
Definition: Pseudoknot PKg of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1_UPD-PKg
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 5
2 0 3
Position Paired:
6800-6802; 6810-6812
6805-6809; 6816-6820
Bracket view of structure:
            6800      6810      6820
      #       9|123456789|123456789|1
      $  6799 UCGUGGUCAGUACGAUAACUGAU=6821
      %  6799 :(((::[[[[[))):::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00199.html