Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV1_UPD-PKh

PKB-number: PKB200
Definition: Pseudoknot PKh of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA1
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV1_UPD-PKh
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: L07937
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
4 7
1 0 3
Position Paired:
6774-6777; 6786-6789
6779-6785; 6793-6799
Bracket view of structure:
                 6780      6790      6800
      #      3456789|123456789|123456789|
      $ 6773 AGUCUAAUUUGUCGGGCUGAGACAAAUC=6800
      % 6773 :((((:[[[[[[[)))):::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00200.html