Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV2_UPD-PKb

PKB-number: PKB201
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA2
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV2_UPD-PKb
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: X81639
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 7
1 0 5
Position Paired:
3424-3426; 3435-3437
3428-3434; 3443-3449
Bracket view of structure:
                  3430      3440      3450
      #      23456789|123456789|123456789|
      $ 3422 GGCGUUCUACAGUACGUUUAAACUGUAGG=3450
      % 3422 ::(((:[[[[[[[))):::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00201.html