Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV2_UPD-PKi

PKB-number: PKB202
Definition: Pseudoknot PKi of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA2
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV2_UPD-PKi
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: X81639
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
4 7
3 0 7
Position Paired:
3385-3388; 3399-3402
3392-3398; 3410-3416
Bracket view of structure:
                3390      3400      3410
      #      456789|123456789|123456789|1234567
      $ 3384 UGGUGCUUGUUAUUUCACCUAAAUCGAAAUAACG=3417
      % 3384 :((((:::[[[[[[[)))):::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00202.html