Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV2_UPD-PKk

PKB-number: PKB203
Definition: Pseudoknot PKk of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA2
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV2_UPD-PKk
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: X81639
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
3363-3365; 3373-3375
3367-3372; 3379-3384
Bracket view of structure:
                  3370      3380
      #      23456789|123456789|12345
      $ 3362 ACGUGGUCUUCACGAUAGAAGAUG=3385
      % 3362 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00203.html