Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SBWMV2_UPD-PKl

PKB-number: PKB204
Definition: Pseudoknot PKl of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA2
Organism: soil-borne wheat mosaic virus
Abbreviation: SBWMV2_UPD-PKl
RNA type: Viral 3 UTR
Keywords: furovirus
EMBL number: X81639
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R., Pleij C.W.A. & Huth W. (1999). Arch. Virol. 144:2125-2140.
Stem sizes:
Loop sizes:
4 5
3 0 6
Position Paired:
3336-3339; 3348-3351
3343-3347; 3358-3362
Bracket view of structure:
               3340      3350      3360
      #      56789|123456789|123456789|123
      $ 3335 CAGAGUUAUCAUACUCUAUAAACUAUGAC=3363
      % 3335 :((((:::[[[[[))))::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00204.html