Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Hs_PrP

PKB-number: PKB206
Definition: Pseudoknot in the PrP-encoding mRNA
Organism: Homo sapiens
Abbreviation: Hs_PrP
RNA type: mRNA
Keywords: prion; Creutzfeldt-Jacob disease (CJD); Bovine spongiform encephalopathy (BSE)
EMBL number: M13899
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; 3D-modelling
References: [1] Wills P.R. (1992). J. Theor. Biol. 159:523-527.
[2] Barrette I., Poisson G., Gendron P. & Major F. (2001). Nucleic Acids Res. 29:753-758.
Comment: This region of the prion-encoding mRNA contains several sequence repeats with possible similar pseudoknot structures. Homologous pseudoknots have been suggested for some other PrP mRNAs [2].
Stem sizes:
Loop sizes:
6 5
13 0 4
Position Paired:
229-234; 253-258
248-252; 263-267
Bracket view of structure:
              230       240       250       260       270
      #     6789|123456789|123456789|123456789|123456789|
      $ 226 GCCUCAUGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGG=270
      % 226 :::((((((:::::::::::::[[[[[))))))::::]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00206.html