Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Bt_PrP

PKB-number: PKB207
Definition: Pseudoknot in the PrP-encoding mRNA
Organism: Bos Taurus (cow)
Abbreviation: Bt_PrP
RNA type: mRNA
Keywords: prion; Creutzfeldt-Jacob disease (CJD); Bovine spongiform encephalopathy (BSE)
EMBL number: AF117327
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; 3D-modelling
References: [1] Barrette I., Poisson G., Gendron P. & Major F. (2001). Nucleic Acids Res. 29:753-758.
Comment: This region of the prion-encoding mRNA contains several sequence repeats with possible similar pseudoknot structures. Homologous pseudoknots have been suggested for some other PrP mRNAs [1].
Stem sizes:
Loop sizes:
6 6
12 0 4
Position Paired:
69-74; 93-98
87-92; 103-108
Bracket view of structure:
              70        80        90       100       110
      #    6789|123456789|123456789|123456789|123456789|
      $ 66 GCCCCAUGGAGGUGGCUGGGGCCAGCCUCAUGGAGGUGGCUGGGG=110
      % 66 :::((((((::::::::::::[[[[[[))))))::::]]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00207.html