Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVDV_IRES

PKB-number: PKB208
Definition: IRES domain IIIef
Organism: Bovine viral diarrhea virus
Abbreviation: BVDV_IRES
RNA type: Viral 5 UTR
Keywords: flaviviridae; pestivirus; translation; internal ribosomal entry site (IRES)
EMBL number: M31182
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Brown E.A. et al. (1992). Nucleic Acids Res. 20:5041-5045.
[2] Wang C. et al. (1995). RNA 1:526-537.
Stem sizes:
Loop sizes:
14 7
185 1 5
Position Paired:
139-145; 355-361
146-152; 346-352
153-154; 321-322
323-326; 331-334
338-344; 367-373
Bracket view of structure:
            140       150
      #     89|123456789|12345(164)
      $ 138 GGGUAGCAACAGUGGUGA=155
      % 138 :((((((((((((((((:
           320       330       340       350       360       370
      #(164)|123456789|123456789|123456789|123456789|123456789|1234
      $ 320 ACAGCCUGAUAGGGUGCUGCAGAGGCCCACUGUAUUGCUACUAAAAAUCUCUGCU=374
      % 320 :))((((::::)))):::[[[[[[[:)))))))::))))))):::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00208.html