Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CSFV_IRES

PKB-number: PKB209
Definition: IRES domain IIIef
Organism: Classical swine fever virus (hog cholera virus)
Abbreviation: CSFV_IRES
RNA type: Viral 5 UTR
Keywords: flaviviridae; pestivirus; translation; internal ribosomal entry site (IRES)
EMBL number: M31768
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] Brown E.A. et al. (1992). Nucleic Acids Res. 20:5041-5045.
[2] Wang C. et al. (1995). RNA 1:526-537.
[3] Rijnbrand R. et al. (1997). J. Virol. 71:451-457.
[4] Kolupaeva V.G. et al. (2000). RNA 6:1791-1807.
Stem sizes:
Loop sizes:
14 7
179 1 7
Position Paired:
118-124; 328-334
125-131; 319-325
132-133; 294-295
296-299; 304-307
311-317; 342-348
Bracket view of structure:
             120       130
      #     789|123456789|1234(158)
      $ 117 GACUAGCCGUAGUGGCGA=134
      % 117 :((((((((((((((((:
                300       310       320        330       340       350
      #(158)3456789|123456789|123456789|123456789|123456789|123456789|
      $ 293 ACGACCUGAUAGGGUGCUGCAGAGGCCCACUAUUAGGCUAGUAUAAAAAUCUCUGCUG=350
      % 293 :))((((::::)))):::[[[[[[[:)))))))::))))))):::::::]]]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-3-7 PKB00209.html