Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Bp_PK2

PKB-number: PKB210
Definition: Pseudoknot PK2 of Bordetella pertussis tmRNA
Organism: Bordetella pertussis
Abbreviation: Bp_PK2
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA; beta-proteobacteria
EMBL number:
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison; 3D-modeling
References: [1]Felden B., Massire C., Westhof E., Atkins J.F. & Gesteland R.F. (2001). Nucleic Acids Res. 29:1602-1607.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna).
[3] Knudsen B., Wower J., Zwieb C. & Gorodkin J. (2001). Nucleic Acids Res. 29:171-172. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/).
Comment: This type of the PK2 pseudoknot structure is conserved in tmRNAs from the beta-proteobacteria [1].
Stem sizes:
Loop sizes:
9 7
3 2 7
Position Paired:
133-138; 201-206
141-143; 156-158
147-153; 214-220
160-163; 196-199
164-169; 174-179
181-184; 189-192
Bracket view of structure:
                  140       150       160       170       180       190
      #     23456789|123456789|123456789|123456789|123456789|123456789|
      $ 132 CCGCUGCACUGAUCUGUCCUUGGGUCAGGCGGGGGAAGGCAACUUCCCAGGGGGCAACC=190
      % 132 :((((((::(((:::[[[[[[[::))):((((((((((::::)))))):((((::::))
                   200       210       220
      #     123456789|123456789|123456789|1
      $ 191 CCGAACCGCAGCAGCGACAUUCACAAGGAAU=221
      % 191 )):::)))):)))))):::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00210.html