Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PSIV_IRES-PKII

PKB-number: PKB211
Definition: Pseudoknot PKII of the internal ribosomal entry site (IRES) region
Organism: Plautia stali intestine virus
Abbreviation: PSIV_IRES-PKII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AB006531
Submitted by: A.P.Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274
Stem sizes:
Loop sizes:
18 5
10 7 69
Position Paired:
6005-6011; 6066-6072
6018-6028; 6051-6061
6039-6043; 6142-6146
Bracket view of structure:
                6010      6020      6030      6040      6050      6060      6070
      #      456789|123456789|123456789|123456789|123456789|123456789|123456789|123(66)
      $ 6004 UGACUAUGUGAUCUUAUUAAAAUUAGGUUAAAUUUCGAGGUUAAAAAUAGUUUUAAUAUUGCUAUAGUCU=6073
      % 6004 :(((((((::::::(((((((((((::::::::::[[[[[:::::::)))))))))))::::))))))):
           6140
      # (66) |123456789
      $ 6140 ACCCUCGUGC=6149
      % 6140 ::]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00211.html