Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PSIV_IRES-PKIII

PKB-number: PKB212
Definition: Pseudoknot PKIII of the internal ribosomal entry site (IRES) region
Organism: Plautia stali intestine virus
Abbreviation: PSIV_IRES-PKIII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AB006531
Submitted by: A.P.Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
4 9
19 0 15
Position Paired:
6078-6081; 6111-6114
6084-6087; 6092-6095
6101-6104; 6136-6139
6106-6110; 6130-6134
6115-6118; 6124-6127
Bracket view of structure:
             6080      6090      6100      6110      6120      6130      6140
      #      789|123456789|123456789|123456789|123456789|123456789|123456789|
      $ 6077 AGGUCUUGUAUAUUUAUACUUACCACACAAGAUGGACCGGAGCAGCCCUCCAAUAUCUAGUGUA=6140
      % 6077 :((((::((((::::)))):::::[[[[:[[[[[))))((((:::::))))::]]]]]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00212.html