Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HiPV_IRES-PKI

PKB-number: PKB213
Definition: Pseudoknot PKI of the internal ribosomal entry site (IRES) region
Organism: Himetobi P virus
Abbreviation: HiPV_IRES-PKI
RNA type: Viral others
Keywords: Picornaviriadae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AB017037
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
9 5
1 0 9
Position Paired:
6430-6434; 6454-6458
6438-6441; 6448-6451
6443-6447; 6468-6472
Bracket view of structure:
           6430      6440      6450      6460      6470
      #      9|123456789|123456789|123456789|123456789|123
      $ 6429 CAGCCUUGUAGUUUUAGUGGACUUUAGGCUAAAGAAUUUCACUAG=6473
      % 6429 :(((((:::((((:[[[[[))))::))))):::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00213.html