Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HiPV_IRES-PKIII

PKB-number: PKB215
Definition: Pseudoknot PKIII of the internal ribosomal entry site (IRES) region
Organism: Himetobi P virus
Abbreviation: HiPV_IRES-PKIII
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AB017037
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
4 9
19 0 15
Position Paired:
6358-6361; 6391-6394
6364-6367; 6372-6375
6381-6384; 6416-6419
6386-6390; 6410-6414
6395-6398; 6404-6407
Bracket view of structure:
             6360      6370      6380      6390      6400      6410      6420
      #      789|123456789|123456789|123456789|123456789|123456789|123456789|
      $ 6357 GACCCUUAGUUAUUUAGCUUUACCGCCCAGGAUGGGGUGCAGCGUUCCUGCAAUAUCCAGGGCA=6420
      % 6357 :((((::((((::::)))):::::[[[[:[[[[[))))((((:::::))))::]]]]]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00215.html